About   Help   FAQ
Mlklem1Najaf
Endonuclease-mediated Allele Detail
Summary
Symbol: Mlklem1Najaf
Name: mixed lineage kinase domain-like; endonuclease-mediated mutation 1, Ayaz Najafov
MGI ID: MGI:7550372
Synonyms: MLKLS345A;S347A, SA2
Gene: Mlkl  Location: Chr8:112038429-112064809 bp, - strand  Genetic Position: Chr8, 57.98 cM, cytoband D3
Alliance: Mlklem1Najaf page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsCRISPR/cas9 endonuclease-mediated genome editing is used to insert serine to alanine amino acid substitutions at codons 345 and 347 (S345A TCC to GCC, S347A AGC to GCC) in exon 8. Mlkl transcript Mlkl-201 (ENSMUSG00000012519) was used as reference for the exon number and guide sequences. crRNA (AAACACAGAAUUCCAUCAGCGUUUUAGAGCUAUGCUGUUUUG), cas9 endonuclease and a single strain oligo template (tttcaacgtctgcatctaacacatctgtctgtctagCTTGCAGGATTTGAGTTAAGCAAAACACAGAATGCCAT CGCCCGAACAGCAAAGAGCACTAAAGCAGAGAGATCCAGTTCAACG) are used. The substitutions block RIPK3 phosphorylation events blocking necroptotic cell death. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Mlkl Mutation:  33 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory