Prkd2^em1Btlr
Endonuclease-mediated Allele Detail

Summary

• Symbol: Prkd2^em1Btlr
• Name: protein kinase D2; endonuclease-mediated mutation 1, Bruce Beutler
• MGI ID: MGI:7549275
• Synonyms: Prkd2^W807R
• Gene: Prkd2 Location: Chr7:16576827-16604386 bp, + strand Genetic Position: Chr7, 9.15 cM
• Alliance: Prkd2^em1Btlr page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Single point mutation
• Mutation details: Tryptophan codon 807 (TGG) in exon 17 was changed to arginine (AGG) (p.W807R) using an sgRNA (targeting TCTCAGCCACCCATGGTTAC) and an ssODN template with CRISPR/Cas9 technology. The mutation recapitulates the ENU-induced Purnama allele. (J:296761)
• Inheritance: Semidominant

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Prkd2 Mutation: 43 strains or lines available

References

• Original: J:296761 Misawa T, et al., Mutual inhibition between Prkd2 and Bcl6 controls T follicular helper cell differentiation. Sci Immunol. 2020 Jan 24;5(43)
• All: 1 reference(s)