Trp53bp1^em1Btlr
Endonuclease-mediated Allele Detail

Summary

• Symbol: Trp53bp1^em1Btlr
• Name: transformation related protein 53 binding protein 1; endonuclease-mediated mutation 1, Bruce Beutler
• MGI ID: MGI:7549273
• Synonyms: Trp53bp1^-
• Gene: Trp53bp1 Location: Chr2:121023762-121101888 bp, - strand Genetic Position: Chr2, 60.37 cM
• Alliance: Trp53bp1^em1Btlr page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Not Specified
• Mutation details: A knockout allele was created using an sgRNA (targeting TTTGACCAGAGTAGTAAAACAGG in exon 8) with CRISPR/Cas9 technology. This allele recapitulates the phenotype of the ENU-induced lentil mutation. (J:217665)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Trp53bp1 Mutation: 100 strains or lines available

References

• Original: J:217665 Wang T, et al., Real-time resolution of point mutations that cause phenovariance in mice. Proc Natl Acad Sci U S A. 2015 Feb 3;112(5):E440-9
• All: 2 reference(s)