Tmeff1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmeff1^em1(IMPC)J
• Name: transmembrane protein with EGF-like and two follistatin-like domains 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7548809
• Gene: Tmeff1 Location: Chr4:48585174-48663131 bp, + strand Genetic Position: Chr4, 26.15 cM, cytoband B2
• Alliance: Tmeff1^em1(IMPC)J page
• IMPC: Tmeff1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTACTAGGCATCTCATTCAC and AATGTCAGATTACAAAACGG, which resulted in a 317 bp deletion beginning at Chromosome 4 position 48,604,417 bp and ending after 48,604,733 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000178348 (exon 2) and 207 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 57 and early stop 18 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tmeff1 Mutation: 25 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)