Tagln3em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Tagln3em1(IMPC)J |
Name: |
transgelin 3; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:7548782 |
Gene: |
Tagln3 Location: Chr16:45531593-45544971 bp, - strand Genetic Position: Chr16, 29.99 cM
|
Alliance: |
Tagln3em1(IMPC)J page
|
IMPC: |
Tagln3 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGATTCCCTGTGCTGCTTGG and TGATCTCCCATTCTTAATGG, which resulted in a 545 bp deletion beginning at Chromosome 16 position 45,722,809 bp and ending after 45,723,353 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000129242 (exon 2) and 370 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 60 and early stop 10 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|