About   Help   FAQ
Bmal1em1Joli
Endonuclease-mediated Allele Detail
Summary
Symbol: Bmal1em1Joli
Name: basic helix-loop-helix ARNT like 1; endonuclease-mediated mutation 1, Jonathan O Lipton
MGI ID: MGI:7547390
Synonyms: Bmal1-S42A
Gene: Bmal1  Location: Chr7:112806672-112913333 bp, + strand  Genetic Position: Chr7, 59.17 cM, cytoband F2-F3
Alliance: Bmal1em1Joli page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsSerine codon 42 (AGT) in exon 5 (in ENSMUST00000047321) was changed to alanine (GCC) (p.S42A) using an sgRNA (targeting GTGTGGACTGCAATCGCAAG) and an ssODN template with CRISPR/Cas9 technology. The mutation renders the affected residue in the encoded peptide unphosphorylatable. (J:342247)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Bmal1 Mutation:  139 strains or lines available
References
Original:  J:342247 Barone I, et al., Synaptic BMAL1 phosphorylation controls circadian hippocampal plasticity. Sci Adv. 2023 Oct 27;9(43):eadj1010
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory