Myrf^em1Zhif
Endonuclease-mediated Allele Detail

Summary

• Symbol: Myrf^em1Zhif
• Name: myelin regulatory factor; endonuclease-mediated mutation 1, Zhigang Fan
• MGI ID: MGI:7547374
• Synonyms: MYRF^mut
• Gene: Myrf Location: Chr19:10185636-10218112 bp, - strand Genetic Position: Chr19, 6.54 cM
• Alliance: Myrf^em1Zhif page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Intragenic deletion
• Mutation details: A single nucleotide deletion (GRCm39:chr19:10200883Gdel, c.789Cdel) was engineered in exon 6 (in ENSMUST00000189897) using an sgRNA (targeting GGCAAGGCTGTGACAGTCCCAGG) and an ssODN template with CRISPR/Cas9 technology, leading to a frameshift and premature stop codon (p.N264Tfs*8). The mutation is the equivalent of the human c.789Cdel, p.S264Afs*8 mutation associated with nanophthalmos. (J:302837)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Myrf Mutation: 102 strains or lines available

References

• Original: J:302837 Yu X, et al., Nanophthalmos-Associated MYRF Gene Mutation Causes Ciliary Zonule Defects in Mice. Invest Ophthalmol Vis Sci. 2021 Mar 1;62(3):1
• All: 1 reference(s)