Ripk1^em1Dov
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ripk1^em1Dov
• Name: receptor (TNFRSF)-interacting serine-threonine kinase 1; endonuclease-mediated mutation 1, Domagoj Vucic
• MGI ID: MGI:7547311
• Synonyms: Ripk1^K115R
• Gene: Ripk1 Location: Chr13:34186346-34221130 bp, + strand Genetic Position: Chr13, 14.01 cM
• Alliance: Ripk1^em1Dov page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Lysine codon 115 (AAA) in exon 4 was changed to arginine (CGA) (p.K115R) using an sgRNA (targeting GAAAGGAAGGATAATCGTGG) and an ssODN template using CRISPR/Cas9 technology. The mutation affects ubiquination at the residue in the encoded peptide. (J:303001)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ripk1 Mutation: 32 strains or lines available

References

• Original: J:303001 Kist M, et al., Impaired RIPK1 ubiquitination sensitizes mice to TNF toxicity and inflammatory cell death. Cell Death Differ. 2021 Mar;28(3):985-1000
• All: 1 reference(s)