About   Help   FAQ
Arl14epem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Arl14epem1(IMPC)J
Name: ADP-ribosylation factor-like 14 effector protein; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7545684
Gene: Arl14ep  Location: Chr2:106792874-106804742 bp, - strand  Genetic Position: Chr2, 55.97 cM, cytoband E3
Alliance: Arl14epem1(IMPC)J page
IMPC: Arl14ep gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAGTTAAACCTGAAAGCCA and AAACTGCATTCCAGACTCGG, which resulted in a 475 bp deletion beginning at Chromosome 2 position 106,966,958 bp and ending after 106,967,432 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001208985 (exon 3) and 347 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 141 and early truncation 7 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Arl14ep Mutation:  14 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory