Nhlrc1^em1Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nhlrc1^em1Tcp
• Name: NHL repeat containing 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7545165
• Synonyms: Malin^FLAG
• Gene: Nhlrc1 Location: Chr13:47166033-47168326 bp, - strand Genetic Position: Chr13, 24.5 cM
• Alliance: Nhlrc1^em1Tcp page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Epitope tag)
• Mutation: Insertion
• Mutation details: This allele was generated at The Centre for Phenogenomics by microinjecting Cas9 mRNA with a guide RNA with the spacer sequence AGCGGAGCAGCGGGAGCAAT and a single-stranded oligonucleotide repair template. This resulted in the insertion of a FLAG tag at the N-terminus. (J:334420)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Nhlrc1 Mutation: 16 strains or lines available

References

• Original: J:334420 Mitra S, et al., Laforin targets malin to glycogen in Lafora progressive myoclonus epilepsy. Dis Model Mech. 2023 Jan 1;16(1)
• All: 1 reference(s)