Prr16em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Prr16em1(IMPC)J |
Name: |
proline rich 16; endonuclease-mediated mutation, Jackson |
MGI ID: |
MGI:7543712 |
Gene: |
Prr16 Location: Chr18:51250970-51437713 bp, + strand Genetic Position: Chr18, 27.97 cM
|
Alliance: |
Prr16em1(IMPC)J page
|
IMPC: |
Prr16 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutations: |
|
Insertion, Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAGCTGTAGATCAGAGGTCA and TGGTAGTGGTGGATTTCCTC, which resulted in a 708 bp deletion beginning at Chromosome 18 position 51,302,635 bp and ending after 51,303,342 bp (GRCm38/mm10). This mutation deletes 708 bp from ENSMUSE00000707416 (exon 2) and because of the 1 bp G insertion is predicted to cause a change of amino acid sequence after residue 61 and early truncation 12 amino acids later. There is a 1 bp insertion (G) at the deletion site.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|