Il2rg^em1Slc
Endonuclease-mediated Allele Detail

Summary

• Symbol: Il2rg^em1Slc
• Name: interleukin 2 receptor, gamma chain; endonuclease-mediated mutation 1, Japan SLC
• MGI ID: MGI:7541496
• Synonyms: Il2rg^-
• Gene: Il2rg Location: ChrX:100307991-100311861 bp, - strand Genetic Position: ChrX, 43.9 cM
• Alliance: Il2rg^em1Slc page

Mutation origin

• Strain of Origin: C.Cg-Foxn1^nu/Slc

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exons 3 and 8 were targeted with sgRNAs (targeting CCAGGAGTGCAGTCACTATTTGT and CCTTTTTCTACCTATGATTCAAC) using CRISPR/Cas9 technology, resulting in a deletion. The allele was targeted in Foxn1^nu mice. (J:341230)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Il2rg Mutation: 132 strains or lines available

References

• Original: J:341230 Takagi Y, et al., Characterization of novel, severely immunodeficient Prkdc(Deltaex57/Deltaex57) mice. Biochem Biophys Res Commun. 2023 Oct 20;678:193-199
• All: 1 reference(s)