Slc5a11^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc5a11^em1(IMPC)Tcp
• Name: solute carrier family 5 (sodium/glucose cotransporter), member 11; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:7541410
• Gene: Slc5a11 Location: Chr7:122814003-122872476 bp, + strand Genetic Position: Chr7, 67.42 cM
• Alliance: Slc5a11^em1(IMPC)Tcp page
• IMPC: Slc5a11 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CTCAAACTTAACTGCCCACG targeting the 5' side and GCTTCAGGGCTGCTATTCGA targeting the 3' side of a critical region (ENSMUSE00000256977). This resulted in a 2320-bp deletion of Chr7 from 122848218 to 122850537 (GRCm39) introducing a frameshift and premature stop codon. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Slc5a11 Mutation: 75 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 1 reference(s)