Dhx9^em1Atsug
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dhx9^em1Atsug
• Name: DExH-box helicase 9; endonuclease-mediated mutation 1, Atsushi Sugie
• MGI ID: MGI:7541265
• Synonyms: Dhx9^G416R
• Gene: Dhx9 Location: Chr1:153331504-153363406 bp, - strand Genetic Position: Chr1, 65.37 cM
• Alliance: Dhx9^em1Atsug page

Mutation origin

• Strain of Origin: (C57BL/6 x C3H)F1

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Glycine codon 416 (GGT) in exon 12 was changed to arginine (CGG) (p.G416R) using an sgRNA (targeting GTGATTATCCGAGGGGCTAC) and an ssODN template with CRISPR/Cas9 technology. The mutation represents the human p.G414R mutation found in a patient with a neurodevelopmental disorder. (J:339227)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Dhx9 Mutation: 77 strains or lines available

References

• Original: J:339227 Yamada M, et al., Heterozygous loss-of-function DHX9 variants are associated with neurodevelopmental disorders: Human genetic and experimental evidences. Eur J Med Genet. 2023 Aug;66(8):104804
• All: 1 reference(s)