Fnip2^em1Efe
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fnip2^em1Efe
• Name: folliculin interacting protein 2; endonuclease-mediated mutation 1, Alejo Efeyan
• MGI ID: MGI:7541204
• Synonyms: Fnip2^C
• Gene: Fnip2 Location: Chr3:79363281-79475103 bp, - strand Genetic Position: Chr3, 34.91 cM
• Alliance: Fnip2^em1Efe page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: A T-to-C nucleotide change was engineered in the 3' UTR (GRCm39:chr3:79364590A>G) using an sgRNA (targeting GATAAGTGATATGAATGTAT) and an ssODN template with CRISPR/Cas9 technology. This mutation represents a human T>C mutation (SNP rs2299007) in the 3' UTR that affects miR-181b-5p binding and is associated with metabolic and obesityrelated phenotypes. (J:339560)

Expression

In Mice Carrying this Mutation:

1 RNA-Seq or microarray experiment(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Fnip2 Mutation: 60 strains or lines available

References

• Original: J:339560 Fernandez LP, et al., Folliculin-interacting protein FNIP2 impacts on overweight and obesity through a polymorphism in a conserved 3' untranslated region. Genome Biol. 2022 Oct 31;23(1):230
• All: 1 reference(s)