Slc37a4^em2Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc37a4^em2Lutzy
• Name: solute carrier family 37 (glucose-6-phosphate transporter), member 4; endonuclease-mediated mutation 2, Cathleen Lutz
• MGI ID: MGI:7541200
• Synonyms: Slc37a4 Exon 3 cKO
• Gene: Slc37a4 Location: Chr9:44308243-44314263 bp, + strand Genetic Position: Chr9, 24.84 cM, cytoband B
• Alliance: Slc37a4^em2Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready)
• Mutation: Insertion
• Mutation details: CRISPR/cas9 genome editing uses guide RNAs (GGGATATTTTAGGAGCCTGA, ATATTTTAGGAGCCTGAGGG, ATTCCTTCGCCTACATCCAG, TTGCCACTGGATGTAGGCGA) to excise and replace murine exon 3 with a loxP-flanked wild type exon 3 cassette. Slc37a4 transcript Slc37a4-201 (ENSMUST00000165839.3) was used as reference for the exon number and guide sequences. (J:94077)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Slc37a4 Mutation: 17 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 1 reference(s)