Pgm5em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Pgm5em1(IMPC)J |
| Name: |
phosphoglucomutase 5; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:7539831 |
| Gene: |
Pgm5 Location: Chr19:24660380-24839219 bp, - strand Genetic Position: Chr19, 19.78 cM
|
| Alliance: |
Pgm5em1(IMPC)J page
|
| IMPC: |
Pgm5 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TATAGCCTCTCAGATGCACA and AAGTAGTTATTAGGTGGCAG, which resulted in a 538 bp deletion beginning at Chromosome 19 position 24,834,581 bp and ending after 24,835,118 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001204964 (exon 2) and 375 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 87 and early truncation 75 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
1 reference(s) |
|