Nfx1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Nfx1em1(IMPC)J |
Name: |
nuclear transcription factor, X-box binding 1; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:7539829 |
Gene: |
Nfx1 Location: Chr4:40970906-41025992 bp, + strand Genetic Position: Chr4, 20.72 cM, cytoband B1
|
Alliance: |
Nfx1em1(IMPC)J page
|
IMPC: |
Nfx1 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTCAGAATGTACGATAACAT and GTTGTCGCTTAACAAGAAGG, which resulted in a 313 bp deletion beginning at Chromosome 4 position 40,988,503 bp and ending after 40,988,815 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000344981 (exon 5) and 207 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 417 and early truncation 45 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|