Lacc1^em2Flv
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lacc1^em2Flv
• Name: laccase domain containing 1; endonuclease-mediated mutation 2, Richard A Flavell
• MGI ID: MGI:7539560
• Synonyms: Lacc1^C284R
• Gene: Lacc1 Location: Chr14:77261640-77274344 bp, - strand Genetic Position: Chr14, 40.63 cM
• Alliance: Lacc1^em2Flv page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Cysteine codon 284 (TGT) in exon 5 was changed to arginine (CGT) (p.C284R) using an sgRNA (targeting GAAGACGATGGGTATACAGTCGG) and an ssODN template with CRISPR/Cas9 technology. The mutation represents the same human mutation (SNP) associated with early-onset Crohns disease (CD), ankylosing spondylitis, systemic juvenile idiopathic arthritis and a high-risk state for leprosy. (J:339910)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Lacc1 Mutation: 31 strains or lines available

References

• Original: J:339910 Wei Z, et al., LACC1 bridges NOS2 and polyamine metabolism in inflammatory macrophages. Nature. 2022 Sep;609(7926):348-353
• All: 1 reference(s)