Daxx^em3Glo
Endonuclease-mediated Allele Detail

Summary

• Symbol: Daxx^em3Glo
• Name: Fas death domain-associated protein; endonuclease-mediated mutation 3, Guillermina Lozano
• MGI ID: MGI:7539427
• Synonyms: Daxx^S226A
• Gene: Daxx Location: Chr17:34128388-34134564 bp, + strand Genetic Position: Chr17, 17.98 cM
• Alliance: Daxx^em3Glo page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Serine codon 226 (TCC) in exon 3 was changed to alanine (GCT) (p.S226A) using an sgRNA (targeting GCGGGCCTCCTGCAAATACG) and an ssODN template with CRISPR/Cas9 technology. The mutation, in the histone binding domain of the encoded peptide, affects histone H3.3 binding. (J:340029)

Expression

In Mice Carrying this Mutation:

1 RNA-Seq or microarray experiment(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Daxx Mutation: 34 strains or lines available

References

• Original: J:340029 Sun C, et al., The histone chaperone function of Daxx is dispensable for embryonic development. Cell Death Dis. 2023 Aug 26;14(8):565
• All: 1 reference(s)