Ikzf3^em4Itan
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ikzf3^em4Itan
• Name: IKAROS family zinc finger 3; endonuclease-mediated mutation 4, Ichiro Taniuchi
• MGI ID: MGI:7539398
• Synonyms: Ikzf3^N159S
• Gene: Ikzf3 Location: Chr11:98355728-98436857 bp, - strand Genetic Position: Chr11, 61.75 cM
• Alliance: Ikzf3^em4Itan page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Asparagine codon 159 (AAC) in exon 5 was changed to serine (AGT) (p.N159S) using a crRNA (targeting GCAGTTTAATATGACGGAGAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.N160S dominant-negative mutation associated with combined immunodeficiency (CID). (J:340322)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ikzf3 Mutation: 33 strains or lines available

References

• Original: J:340322 Kuehn HS, et al., T and B cell abnormalities, pneumocystis pneumonia, and chronic lymphocytic leukemia associated with an AIOLOS defect in patients. J Exp Med. 2021 Dec 6;218(12)
• All: 2 reference(s)