About   Help   FAQ
Ikzf3em4Itan
Endonuclease-mediated Allele Detail
Summary
Symbol: Ikzf3em4Itan
Name: IKAROS family zinc finger 3; endonuclease-mediated mutation 4, Ichiro Taniuchi
MGI ID: MGI:7539398
Synonyms: Ikzf3N159S
Gene: Ikzf3  Location: Chr11:98355728-98436857 bp, - strand  Genetic Position: Chr11, 61.75 cM
Alliance: Ikzf3em4Itan page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsAsparagine codon 159 (AAC) in exon 5 was changed to serine (AGT) (p.N159S) using a crRNA (targeting GCAGTTTAATATGACGGAGAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.N160S dominant-negative mutation associated with combined immunodeficiency (CID). (J:340322)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Ikzf3 Mutation:  33 strains or lines available
References
Original:  J:340322 Kuehn HS, et al., T and B cell abnormalities, pneumocystis pneumonia, and chronic lymphocytic leukemia associated with an AIOLOS defect in patients. J Exp Med. 2021 Dec 6;218(12)
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory