Pacs1em5(PACS1*R201W)Lutzy
Endonuclease-mediated Allele Detail
|
Symbol: |
Pacs1em5(PACS1*R201W)Lutzy |
Name: |
phosphofurin acidic cluster sorting protein 1; endonuclease-mediated mutation 5, Cathleen Lutz |
MGI ID: |
MGI:7539214 |
Synonyms: |
LSL-huPacs1-exon4 R201W |
Gene: |
Pacs1 Location: Chr19:5183714-5323138 bp, - strand Genetic Position: Chr19, 4.25 cM
|
Alliance: |
Pacs1em5(PACS1*R201W)Lutzy page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Conditional ready, Humanized sequence) |
Mutations: |
|
Insertion, Nucleotide substitutions
|
|
|
Mutation details: Guide RNAs (CCAGAGGGCCTGGTACTGCA,AGAAAGAAAGAAATGCCAGA,GGGCTATAAAACCTTAGCTG, and GGCTATAAAACCTTAGCTGT) are selected to excise and replace murine exon 4 with a human exon 4 containing the R201W (CGG to TGG, arginine to tryptophan, c.601) variant. A loxP-flanked STOP cassette, which contains a splice acceptor and 3x SV40 polyadenylation sequence is inserted into intron 3/4. Mouse Pcs1 transcript Pac1-201 (ENSMUST00000025786.9) and human PACS1-201 (ENST00000320580.9) were used as reference for the exon number and guide sequences. The mutation is orthologous to the human R203W mutation.
(J:94077)
|
|
|
|
Original: |
J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015; |
All: |
1 reference(s) |
|