About   Help   FAQ
Pik3cdem1Stgt
Endonuclease-mediated Allele Detail
Summary
Symbol: Pik3cdem1Stgt
Name: phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta; endonuclease-mediated mutation 1, Stuart G Tangye
MGI ID: MGI:7539174
Synonyms: Pik3cdE1020K, Pik3cd GOF
Gene: Pik3cd  Location: Chr4:149733625-149787023 bp, - strand  Genetic Position: Chr4, 80.15 cM
Alliance: Pik3cdem1Stgt page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsGlutamic acid codon 1020 (GAA) in exon 22 was changed to lysine (AAA) (p.E1020K) using an sgRNA (targeting GAGCTTCGTTGAACTTCACCCGG) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.E1021K gain-of-function (GOF) mutation associated with PASLI (p110delta-activating mutations causing senescent T cells, lymphadenopathy, and immunodeficiency) disease. (J:292599)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Pik3cd Mutation:  43 strains or lines available
References
Original:  J:292599 Avery DT, et al., Germline-activating mutations in PIK3CD compromise B cell development and function. J Exp Med. 2018 Aug 6;215(8):2073-2095
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory