Pik3r1^em1Ekd
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pik3r1^em1Ekd
• Name: phosphoinositide-3-kinase regulatory subunit 1; endonuclease-mediated mutation 1, Elissa K Deenick
• MGI ID: MGI:7539172
• Synonyms: Pik3r1^E11SpD, Pik3r1 LOF
• Gene: Pik3r1 Location: Chr13:101817269-101904725 bp, - strand Genetic Position: Chr13, 53.92 cM
• Alliance: Pik3r1^em1Ekd page

Mutation origin

• Strain of Origin: C57BL/6JAusb

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: The exon/intron 11 splice donor site was targeted with an sgRNA (targeting GGAGTACACCCGTACTTCCCAGG) and an ssODN template using CRISPR/Cas9 technology, resulting in a G-to-A substitution that changes the G-GT splice site to G-AT, which leads to skipping of in-frame exon 11, which encodes part of the inter-SH2 domain. This mutation is the equivalent of a human splice donor mutation associated with PASLI (p110delta-activating mutations causing senescent T cells, lymphadenopathy, and immunodeficiency) like disease or activated PI3Kdelta syndrome 2. (J:340835)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pik3r1 Mutation: 53 strains or lines available

References

• Original: J:340835 Nguyen T, et al., Human PIK3R1 mutations disrupt lymphocyte differentiation to cause activated PI3Kdelta syndrome 2. J Exp Med. 2023 Jun 5;220(6)
• All: 1 reference(s)