Ptx4em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Ptx4em1(IMPC)J |
Name: |
pentraxin 4; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:7537143 |
Gene: |
Ptx4 Location: Chr17:25339734-25344266 bp, + strand Genetic Position: Chr17, 12.53 cM, cytoband A3.3
|
Alliance: |
Ptx4em1(IMPC)J page
|
IMPC: |
Ptx4 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACAGTTTCAGAGATTCCAAC and CCAAGGACCTACCAAGGACC, which resulted in a 631 bp deletion beginning at Chromosome 17 position 25,122,707 bp and ending after 25,123,337 bp (GRCm38/mm10). This mutation deletes 631 bp from ENSMUSE00000362194 (exon 2) and is predicted to cause a change of amino acid sequence after residue 51 and early truncation 11 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|