Klrk1^em1Ccg
Endonuclease-mediated Allele Detail

Summary

• Symbol: Klrk1^em1Ccg
• Name: killer cell lectin-like receptor subfamily K, member 1; endonuclease-mediated mutation 1, Christopher C Goodnow
• MGI ID: MGI:7537041
• Synonyms: Klrk1^KO
• Gene: Klrk1 Location: Chr6:129587286-129600827 bp, - strand Genetic Position: Chr6, 63.44 cM
• Alliance: Klrk1^em1Ccg page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exons 4 and 8 was targeted with two sgRNAs (targeting TCACAACGTGGTATAGTCCTAGG and GTTGAAGCCTATCCAAACTAGGG) using CRISPR/Cas9 technology, leading to a 4,781 bp deletion encompassing exons 4-8. (J:340910)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Klrk1 Mutation: 24 strains or lines available

References

• Original: J:340910 Masle-Farquhar E, et al., STAT3 gain-of-function mutations connect leukemia with autoimmune disease by pathological NKG2D(hi) CD8(+) T cell dysregulation and accumulation. Immunity. 2022 Dec 13;55(12):2386-2404.e8
• All: 1 reference(s)