Cx3cr1^em1Ccg
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cx3cr1^em1Ccg
• Name: C-X3-C motif chemokine receptor 1; endonuclease-mediated mutation 1, Christopher C Goodnow
• MGI ID: MGI:7537040
• Synonyms: Cx3cr1^KO
• Gene: Cx3cr1 Location: Chr9:119877749-119897362 bp, - strand Genetic Position: Chr9, 71.37 cM
• Alliance: Cx3cr1^em1Ccg page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exon 2 was targeted with an sgRNA (targeting TACGCCCTCGTCTTCACGTTCGG) using CRISPR/Cas9 technology, leading to a 1 bp deletion (GRCm39:chr9:g.119881268delA) that causes a frameshift and a premature stop codon (p.F45Sfs*28). (J:340910)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cx3cr1 Mutation: 49 strains or lines available

References

• Original: J:340910 Masle-Farquhar E, et al., STAT3 gain-of-function mutations connect leukemia with autoimmune disease by pathological NKG2D(hi) CD8(+) T cell dysregulation and accumulation. Immunity. 2022 Dec 13;55(12):2386-2404.e8
• All: 1 reference(s)