About   Help   FAQ
Il10raem1Ccg
Endonuclease-mediated Allele Detail
Summary
Symbol: Il10raem1Ccg
Name: interleukin 10 receptor, alpha; endonuclease-mediated mutation 1, Christopher C Goodnow
MGI ID: MGI:7537039
Synonyms: Il10raKO
Gene: Il10ra  Location: Chr9:45165135-45180447 bp, - strand  Genetic Position: Chr9, 24.84 cM
Alliance: Il10raem1Ccg page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Intragenic deletion, Single point mutation
 
Mutation detailsThreonine codon 86 (ATA) in exon 3 was changed to isoleucine (ACA) (p.T86I) using an sgRNA (targeting GGTGAACGTTGTGAGATCACAGG) and an ssODN template with CRISPR/Cas9 technology. In this allele an unintended 8 bp deletion (TCACAGGA GRCm39:chr9:g.45177878_45177885) caused a frameshift and premature stop codon (p.C83Hfs*33). (J:340910)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Il10ra Mutation:  31 strains or lines available
References
Original:  J:340910 Masle-Farquhar E, et al., STAT3 gain-of-function mutations connect leukemia with autoimmune disease by pathological NKG2D(hi) CD8(+) T cell dysregulation and accumulation. Immunity. 2022 Dec 13;55(12):2386-2404.e8
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory