Il10ra^em1Ccg
Endonuclease-mediated Allele Detail

Summary

• Symbol: Il10ra^em1Ccg
• Name: interleukin 10 receptor, alpha; endonuclease-mediated mutation 1, Christopher C Goodnow
• MGI ID: MGI:7537039
• Synonyms: Il10ra^KO
• Gene: Il10ra Location: Chr9:45165135-45180447 bp, - strand Genetic Position: Chr9, 24.84 cM
• Alliance: Il10ra^em1Ccg page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Intragenic deletion, Single point mutation
• Mutation details: Threonine codon 86 (ATA) in exon 3 was changed to isoleucine (ACA) (p.T86I) using an sgRNA (targeting GGTGAACGTTGTGAGATCACAGG) and an ssODN template with CRISPR/Cas9 technology. In this allele an unintended 8 bp deletion (TCACAGGA GRCm39:chr9:g.45177878_45177885) caused a frameshift and premature stop codon (p.C83Hfs*33). (J:340910)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Il10ra Mutation: 31 strains or lines available

References

• Original: J:340910 Masle-Farquhar E, et al., STAT3 gain-of-function mutations connect leukemia with autoimmune disease by pathological NKG2D(hi) CD8(+) T cell dysregulation and accumulation. Immunity. 2022 Dec 13;55(12):2386-2404.e8
• All: 1 reference(s)