Stat3^em1Ccg
Endonuclease-mediated Allele Detail

Summary

• Symbol: Stat3^em1Ccg
• Name: signal transducer and activator of transcription 3; endonuclease-mediated mutation 1, Christopher C Goodnow
• MGI ID: MGI:7537035
• Synonyms: Stat3^T716M
• Gene: Stat3 Location: Chr11:100777632-100830447 bp, - strand Genetic Position: Chr11, 63.82 cM
• Alliance: Stat3^em1Ccg page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Threonine codon 716 (ACG) in exon 23 was changed to methionine (ATG) (p.T716M) using an sgRNA (targeting CAGGTCAATGGTATTGCTGCAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation, in the TA domain of the encoded peptide, is the equivalent of the same human gain-of-function (GOF) mutation associated with T cell large granular lymphocytic leukemia (T-LGL). (J:340910)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Stat3 Mutation: 72 strains or lines available

References

• Original: J:340910 Masle-Farquhar E, et al., STAT3 gain-of-function mutations connect leukemia with autoimmune disease by pathological NKG2D(hi) CD8(+) T cell dysregulation and accumulation. Immunity. 2022 Dec 13;55(12):2386-2404.e8
• All: 1 reference(s)