About   Help   FAQ
Hdac7em1Daha
Endonuclease-mediated Allele Detail
Summary
Symbol: Hdac7em1Daha
Name: histone deacetylase 7; endonuclease-mediated mutation 1, David A Hafler
MGI ID: MGI:7536998
Synonyms: HDAC7 R150H KI
Gene: Hdac7  Location: Chr15:97690545-97742383 bp, - strand  Genetic Position: Chr15, 53.79 cM, cytoband F2
Alliance: Hdac7em1Daha page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsArginine codon 150 (CGC) in exon 5 was changed to histidine (CAC) (p.R150H) using an sgRNA (targeting CCCGCTCCGTGCTTAGCAGCTTC) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.R166H mutation (SNP rs148755202), a protective variant identified in some multiple sclerosis (MS) patients. (J:340937)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Hdac7 Mutation:  47 strains or lines available
References
Original:  J:340937 Axisa PP, et al., A multiple sclerosis-protective coding variant reveals an essential role for HDAC7 in regulatory T cells. Sci Transl Med. 2022 Dec 14;14(675):eabl3651
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory