Hdac7^em1Daha
Endonuclease-mediated Allele Detail

Summary

• Symbol: Hdac7^em1Daha
• Name: histone deacetylase 7; endonuclease-mediated mutation 1, David A Hafler
• MGI ID: MGI:7536998
• Synonyms: HDAC7 R150H KI
• Gene: Hdac7 Location: Chr15:97690545-97742383 bp, - strand Genetic Position: Chr15, 53.79 cM, cytoband F2
• Alliance: Hdac7^em1Daha page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Arginine codon 150 (CGC) in exon 5 was changed to histidine (CAC) (p.R150H) using an sgRNA (targeting CCCGCTCCGTGCTTAGCAGCTTC) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.R166H mutation (SNP rs148755202), a protective variant identified in some multiple sclerosis (MS) patients. (J:340937)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Hdac7 Mutation: 46 strains or lines available

References

• Original: J:340937 Axisa PP, et al., A multiple sclerosis-protective coding variant reveals an essential role for HDAC7 in regulatory T cells. Sci Transl Med. 2022 Dec 14;14(675):eabl3651
• All: 1 reference(s)