Chchd2^em1Dpn
Endonuclease-mediated Allele Detail

Summary

• Symbol: Chchd2^em1Dpn
• Name: coiled-coil-helix-coiled-coil-helix domain containing 2; endonuclease-mediated mutation 1, Derek P Narendra
• MGI ID: MGI:7532638
• Synonyms: C2^-, C2 KO
• Gene: Chchd2 Location: Chr5:129910002-129916311 bp, - strand Genetic Position: Chr5, 68.26 cM
• Alliance: Chchd2^em1Dpn page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exons 1 and 4 were targeted with sgRNAs (targeting CCCGGGTGACTCCTCCGGCC and GTATGTAGTGTTGGTTACTG) using CRISPR/Cas9 technology, resulting in a deletion from the end of exon 1 to most of exon 4 (GRCm39:chr5-5:129910069-129916053). (J:295994)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Chchd2 Mutation: 6 strains or lines available

References

• Original: J:295994 Liu YT, et al., Loss of CHCHD2 and CHCHD10 activates OMA1 peptidase to disrupt mitochondrial cristae phenocopying patient mutations. Hum Mol Genet. 2020 Jun 3;29(9):1547-1567
• All: 3 reference(s)