Sall4^em1Bird
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sall4^em1Bird
• Name: spalt like transcription factor 4; endonuclease-mediated mutation 1, Adrian Bird
• MGI ID: MGI:7532617
• Synonyms: Sall4 ZFC4mut
• Gene: Sall4 Location: Chr2:168590252-168609121 bp, - strand Genetic Position: Chr2, 88.99 cM
• Alliance: Sall4^em1Bird page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Threonine codon 919 (ACG) in exon 3 was changed to aspartic acid (GAT) (p.T919D) and asparagine codon 922 (AAC) in exon 3 to alanine (GCC) (p.N922A) using an sgRNA (targeting CGTGTGTAACATATGCGGGC) and an ssODN template with CRISPR/Cas9 technology. The mutations affect the AT-binding zinc finger in C2H2 zinc finger cluster 4 (ZFC4) of the encoded peptide. (J:303180)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Sall4 Mutation: 145 strains or lines available

Notes

E14Ju09 ES cell line

References

• Original: J:303180 Pantier R, et al., SALL4 controls cell fate in response to DNA base composition. Mol Cell. 2021 Feb 18;81(4):845-858.e8
• All: 1 reference(s)