Aplnr^em1Lahu
Endonuclease-mediated Allele Detail

Summary

• Symbol: Aplnr^em1Lahu
• Name: apelin receptor; endonuclease-mediated mutation 1, Liaoyuan A Hu
• MGI ID: MGI:7532562
• Synonyms: APJ I107A
• Gene: Aplnr Location: Chr2:84966704-84970267 bp, + strand Genetic Position: Chr2, 49.45 cM, cytoband E1
• Alliance: Aplnr^em1Lahu page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Isoleucine codon 107 (ATC) in exon 1 was changed to alanine (GCC) (p.I107A) using an sgRNA (targeting CGTACATGTTGACAAAGATG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.I109A mutation that eliminates beta-arrestin recruitment by the encoded G protein coupled receptor after activation. (J:303185)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Aplnr Mutation: 29 strains or lines available

References

• Original: J:303185 Li N, et al., Loss of APJ mediated beta-arrestin signalling improves high-fat diet induced metabolic dysfunction but does not alter cardiac function in mice. Biochem J. 2020 Sep 18;477(17):3313-3327
• All: 1 reference(s)