Rptor^em2Rjsh
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rptor^em2Rjsh
• Name: regulatory associated protein of MTOR, complex 1; endonuclease-mediated mutation 2, Reuben J Shaw
• MGI ID: MGI:7529770
• Synonyms: Raptor^A
• Gene: Rptor Location: Chr11:119493731-119790402 bp, + strand Genetic Position: Chr11, 83.96 cM, cytoband E2
• Alliance: Rptor^em2Rjsh page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Serine codon 792 (TCC) in exon 20 was changed to alanine (GCG) (p.S792A) using an sgRNA (targeting CGGCGAGGACTCACCTATGAGGG) and an ssODN template with CRISPR/Cas9 technology. The mutation replaces a phosphorylatable residue in the encoded peptide to a phosphoblocker. (J:303713)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rptor Mutation: 114 strains or lines available

References

• Original: J:303713 Van Nostrand JL, et al., AMPK regulation of Raptor and TSC2 mediate metformin effects on transcriptional control of anabolism and inflammation. Genes Dev. 2020 Oct 1;34(19-20):1330-1344
• All: 1 reference(s)