Ntrk2^em1Tac
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ntrk2^em1Tac
• Name: neurotrophic tyrosine kinase, receptor, type 2; endonuclease-mediated mutation 1, Taconic
• MGI ID: MGI:7529665
• Synonyms: Ntrk2^{em6006(Y433F)Tac}, TRKB.Y433F
• Gene: Ntrk2 Location: Chr13:58954383-59281784 bp, + strand Genetic Position: Chr13, 31.2 cM
• Alliance: Ntrk2^em1Tac page

Mutation origin

• Strain of Origin: C57BL/6NTac

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Tyrosine codon 433 (TAT) in exon 12 was changed to phenylalanine (TTC) (NM_001025074:c.1298_1299delATinsTC, p.Y433F) using an sgRNA (targeting TCCTCAGGTCTATGCCGTGGTGG) and an ssODN template with CRISPR/Cas9 technology. This mutation, in the CARC domain of the encoded peptide, affects BDNF-induced translocation of NTRK2 to lipid-raft regions on the neuronal surface. (J:303948)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ntrk2 Mutation: 64 strains or lines available

References

• Original: J:303948 Casarotto PC, et al., Antidepressant drugs act by directly binding to TRKB neurotrophin receptors. Cell. 2021 Mar 4;184(5):1299-1313.e19
• All: 2 reference(s)