Ntrk2em1Tac
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ntrk2em1Tac |
| Name: |
neurotrophic tyrosine kinase, receptor, type 2; endonuclease-mediated mutation 1, Taconic |
| MGI ID: |
MGI:7529665 |
| Synonyms: |
Ntrk2em6006(Y433F)Tac, TRKB.Y433F |
| Gene: |
Ntrk2 Location: Chr13:58954383-59281784 bp, + strand Genetic Position: Chr13, 31.2 cM
|
| Alliance: |
Ntrk2em1Tac page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Not Applicable) |
| Mutation: |
|
Nucleotide substitutions
|
| |
|
Mutation details: Tyrosine codon 433 (TAT) in exon 12 was changed to phenylalanine (TTC) (NM_001025074:c.1298_1299delATinsTC, p.Y433F) using an sgRNA (targeting TCCTCAGGTCTATGCCGTGGTGG) and an ssODN template with CRISPR/Cas9 technology. This mutation, in the CARC domain of the encoded peptide, affects BDNF-induced translocation of NTRK2 to lipid-raft regions on the neuronal surface.
(J:303948)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Ntrk2 Mutation: |
63 strains or lines available
|
|
| Original: |
J:303948 Casarotto PC, et al., Antidepressant drugs act by directly binding to TRKB neurotrophin receptors. Cell. 2021 Mar 4;184(5):1299-1313.e19 |
| All: |
2 reference(s) |
|