Cbfa2t3^em1Cswil
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cbfa2t3^em1Cswil
• Name: CBFA2/RUNX1 translocation partner 3; endonuclease-mediated mutation 1, Christopher S Williams
• MGI ID: MGI:7529134
• Synonyms: Mtg16^P209T, Mtg16^T
• Gene: Cbfa2t3 Location: Chr8:123351880-123425848 bp, - strand Genetic Position: Chr8, 71.93 cM, cytoband E1
• Alliance: Cbfa2t3^em1Cswil page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Single point mutation
• Mutation details: Proline codon 209 (CCT) in exon 5 was changed to threonine (ACT) (p.P209T) using an sgRNA (targeting TTTGTTATCCCTTTTCTGAAGG) and an ssODN template with CRISPR/Cas9 technology. This mutation reduces binding of the encoded peptide to TCF3 and TCF12. (J:326199)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cbfa2t3 Mutation: 34 strains or lines available

References

• Original: J:326199 Brown RE, et al., MTG16 regulates colonic epithelial differentiation, colitis, and tumorigenesis by repressing E protein transcription factors. JCI Insight. 2022 May 23;7(10):e153045
• All: 1 reference(s)