Chd2^em1Gfng
Endonuclease-mediated Allele Detail

Summary

• Symbol: Chd2^em1Gfng
• Name: chromodomain helicase DNA binding protein 2; endonuclease-mediated mutation 1, Guoping Feng
• MGI ID: MGI:7526755
• Synonyms: Chd2^em1Guof, Chd2^R1684H, Chd2^RH
• Gene: Chd2 Location: Chr7:73076400-73191494 bp, - strand Genetic Position: Chr7, 41.85 cM
• Alliance: Chd2^em1Gfng page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Arginine codon 1684 (CGT) was changed to histidine (CAT) (c.5051G>A, p.R1684H) using an sgRNA (targeting CCCACCGTTCTGGGAGCTACCGC) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human c.5054G>A p.R1684H mutation associated with autism. (J:334099)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Chd2 Mutation: 190 strains or lines available

References

• Original: J:334099 Wilde JJ, et al., Efficient embryonic homozygous gene conversion via RAD51-enhanced interhomolog repair. Cell. 2021 Jun 10;184(12):3267-3280.e18
• All: 1 reference(s)