Kcnn3em1.1Lutzy
Endonuclease-mediated Allele Detail
|
Symbol: |
Kcnn3em1.1Lutzy |
Name: |
potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3; endonuclease-mediated mutation 1.1, Cathy Lutz |
MGI ID: |
MGI:7526160 |
Gene: |
Kcnn3 Location: Chr3:89427471-89579801 bp, + strand Genetic Position: Chr3, 39.16 cM, cytoband F2
|
Alliance: |
Kcnn3em1.1Lutzy page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
Mutations: |
|
Insertion, Nucleotide substitutions
|
|
|
Mutation details: CRISPR/cas9 genome editing used guide RNAs (GAAATGCCAACACTAAGCCT, AAATGCCAACACTAAGCCTG, ATGCACTCAGTAGGGGCATT, and CATGCACTCAGTAGGGGCAT) to insert a loxP-flanked STOP cassette (which contains a splice acceptor and 3x SV40 polyadenylation sequence) upstream of a mutant exon 5 with a valine to phenylalanine (V556F, GTG to TTT) substitution at position 556 in the gene. The mutation is located in the HA helix. PAM deletion mutations to eliminate recutting with CRISPR/cas9 were inserted in intron 4 and 5. Kcnn3 transcript Kcnn3-201 (ENSMUST00000000811.7) was used as reference for the exon number and guide sequences. The orthologous clinical V555F gain of function mutation is associated with ZimmermannLaband Syndrome (VLS), a cranial malformation syndrome. Cre-mediated recombination removed the LSL cassette.
(J:94077)
|
|
|
|
Original: |
J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015; |
All: |
1 reference(s) |
|