Kcnn3^em1Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kcnn3^em1Lutzy
• Name: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3; endonuclease-mediated mutation 1, Cathy Lutz
• MGI ID: MGI:7526139
• Gene: Kcnn3 Location: Chr3:89427471-89579801 bp, + strand Genetic Position: Chr3, 39.16 cM, cytoband F2
• Alliance: Kcnn3^em1Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, Humanized sequence, Null/knockout)
• Mutations: Insertion, Nucleotide substitutions
• Mutation details: CRISPR/cas9 genome editing used guide RNAS (GAAATGCCAACACTAAGCCT, AAATGCCAACACTAAGCCTG, ATGCACTCAGTAGGGGCATT, and CATGCACTCAGTAGGGGCAT) to insert a loxP-flanked STOP cassette (which contains a splice acceptor and 3x SV40 polyadenylation sequence), upstream of a mutant exon 5 containing a valine to phenylalanine (V556F, GTG to TTT) substitution at position 556 in the gene. The mutation is located in the HA helix. PAM deletion mutations to eliminate recutting with CRISPR/Cas9 are inserted in intron 4 and 5. Kcnn3 transcript Kcnn3-201 (ENSMUST00000000811.7) was used as reference for the exon number and guide sequences. The orthologous clinical V555F gain of function mutation is associated with ZimmermannLaband Syndrome (VLS), a cranial malformation syndrome. (J:94077)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Kcnn3 Mutation: 51 strains or lines available

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 1 reference(s)