About   Help   FAQ
Kcnn3em1Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Kcnn3em1Lutzy
Name: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3; endonuclease-mediated mutation 1, Cathy Lutz
MGI ID: MGI:7526139
Gene: Kcnn3  Location: Chr3:89427471-89579801 bp, + strand  Genetic Position: Chr3, 39.16 cM, cytoband F2
Alliance: Kcnn3em1Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready, Humanized sequence, Null/knockout)
Mutations:    Insertion, Nucleotide substitutions
 
Mutation detailsCRISPR/cas9 genome editing used guide RNAS (GAAATGCCAACACTAAGCCT, AAATGCCAACACTAAGCCTG, ATGCACTCAGTAGGGGCATT, and CATGCACTCAGTAGGGGCAT) to insert a loxP-flanked STOP cassette (which contains a splice acceptor and 3x SV40 polyadenylation sequence), upstream of a mutant exon 5 containing a valine to phenylalanine (V556F, GTG to TTT) substitution at position 556 in the gene. The mutation is located in the HA helix. PAM deletion mutations to eliminate recutting with CRISPR/Cas9 are inserted in intron 4 and 5. Kcnn3 transcript Kcnn3-201 (ENSMUST00000000811.7) was used as reference for the exon number and guide sequences. The orthologous clinical V555F gain of function mutation is associated with ZimmermannLaband Syndrome (VLS), a cranial malformation syndrome. (J:94077)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Kcnn3 Mutation:  51 strains or lines available
References
Original:  J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory