Commd3^em1Ksuz
Endonuclease-mediated Allele Detail

Summary

• Symbol: Commd3^em1Ksuz
• Name: COMM domain containing 3; endonuclease-mediated mutation 1, Kazuhiro Suzuki
• MGI ID: MGI:7526088
• Synonyms: COMMD3^C170A
• Gene: Commd3 Location: Chr2:18677246-18681042 bp, + strand Genetic Position: Chr2, 12.9 cM
• Alliance: Commd3^em1Ksuz page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Cysteine codon 170 (TGC) was changed to alanine (GCC) (p.C170A) using an sgRNA (targeting GATTAATTTTAGTTGCAACA) and an ssODN template with CRISPR/Cas9 technology. The affected residue is located in the COMM domain of the encoded peptide, which is involved in complex formation with COMMD8. This mutation abrogates the inhibitory effect of celastrol on the COMMD3/8 complex. (J:337427)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Commd3 Mutation: 15 strains or lines available

References

• Original: J:337427 Shirai T, et al., Celastrol suppresses humoral immune responses and autoimmunity by targeting the COMMD3/8 complex. Sci Immunol. 2023 Mar 31;8(81):eadc9324
• All: 1 reference(s)