Del(11Gsdma3-Gsdma)1Cnlr
Endonuclease-mediated Allele Detail

Summary

• Symbol: Del(11Gsdma3-Gsdma)1Cnlr
• Name: deletion, Chr 11, Christopher N LaRock 1
• MGI ID: MGI:7522806
• Gene: Del(11Gsdma3-Gsdma)1Cnlr Location: unknown Genetic Position: Chr11, Syntenic

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intergenic deletion
• Del(11Gsdma3-Gsdma)1Cnlr involves 3 genes/genome features (Gsdma3, Gsdma2, Gsdma) View all
• Mutation details: CRISPR/Cas9 technology using the 5 gRNA TTTATGCATCCATCAAGGCT which cut 54 bp upstream of Gsdma3 exon 1 and the 3 gRNA TCGGAGTCATTCATCGGCCA which cut 156 bp downstream of Gsdma1 exon 12, deleted a region of approximately 52 kb that eliminates the coding sequence of all three genes Gsdma, Gsdma2, and Gsdma3 and includes no overlapping genes on either DNA strand. Sequencing confirmed knock-out of all three genes. (J:339428)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Del(11Gsdma3-Gsdma)1Cnlr Mutation: 0 strains or lines available

References

• Original: J:339428 LaRock DL, et al., Group A Streptococcus induces GSDMA-dependent pyroptosis in keratinocytes. Nature. 2022 May;605(7910):527-531
• All: 1 reference(s)