Wdfy4^em1Kmm
Endonuclease-mediated Allele Detail

Summary

• Symbol: Wdfy4^em1Kmm
• Name: WD repeat and FYVE domain containing 4; endonuclease-mediated mutation 1, Kenneth M Murphy
• MGI ID: MGI:7522226
• Gene: Wdfy4 Location: Chr14:32681504-32907465 bp, - strand Genetic Position: Chr14, 19.44 cM
• Alliance: Wdfy4^em1Kmm page

Mutation origin

• Strain of Origin: NOD/ShiLtJ

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/cas9 genome editing uses sgRNAs (CATGTAGCCTTGAGGTACAT and GTCCCCTTTCCTCATAGACT) to delete exon 4. (J:339363)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Wdfy4 Mutation: 142 strains or lines available

References

• Original: J:339363 Ferris ST, et al., WDFY4 deficiency in NOD mice ameliorates autoimmune diabetes and insulitis. Proc Natl Acad Sci U S A. 2023 Mar 28;120(13):e2219956120
• All: 1 reference(s)