Gt(ROSA)26Sor^{em1(CAG-TagBFP,-mKate2,-EGFP)Jich}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gt(ROSA)26Sor^{em1(CAG-TagBFP,-mKate2,-EGFP)Jich}
• Name: gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 1, JIchao Chen
• MGI ID: MGI:7522066
• Synonyms: ROSA^Kaleidoscope
• Gene: Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
• Alliance: Gt(ROSA)26Sor^{em1(CAG-TagBFP,-mKate2,-EGFP)Jich} page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, Inserted expressed sequence, Reporter)
• Mutation: Insertion
• Mutation details: The targeting vector is constructed based on the Ai9 vector from Addgene with the DTA and neomycin sequences present in Ai9 removed. This targeting vector has a final size of 13.7kb, contains (from 5' to 3') a CAG (CMV enhancer/chicken beta-actin) promoter, an FRT site, a loxP-flanked STOP cassette (with stop codons in all 3 reading frames and a triple polyA signal), the Kaleidoscope construct (described in greater detail below), a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), and a polyA signal. CRISPR/cas9 genome editing used gRNA (ACTCCAGTCTTTCTAGAAGA) with 2'-O-Methyl at 3 first and last bases and 3' phosphorothioate bonds between first 3 and last 2 bases. Kaleidoscope contains three fluorescent cell biology reporters separated by 2A self-cleaving sequences. From 5' to 3' it contains a rat lysosomal-associated membrane protein 1 (LAMP1) gene fused to an enhanced monomeric blue fluorescent protein (TagBFP) sequence, a P2A self-cleaving peptide, an N-terminal mitochondrial targeting pre-sequence (derived from human cytochrome c oxidase subunit VIII [COX8A]), fused to a far-red fluorescent protein (mKate2) a T2A self-cleaving peptide, and an enhanced green fluorescent protein sequence fused to human Tubulin Alpha 1c (TUBA1C) sequence. (J:345362)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Gt(ROSA)26Sor Mutation: 1095 strains or lines available

References

• Original: J:345362 Hutchison V, et al., Inducible tricolor reporter mouse for parallel imaging of lysosomes, mitochondria, and microtubules. J Cell Biol. 2024 Jan 1;223(1)
• All: 1 reference(s)