Dynll2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Dynll2em1(IMPC)J |
Name: |
dynein light chain LC8-type 2; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:7520901 |
Gene: |
Dynll2 Location: Chr11:87870351-87878359 bp, - strand Genetic Position: Chr11, 52.35 cM, cytoband C
|
Alliance: |
Dynll2em1(IMPC)J page
|
IMPC: |
Dynll2 gene page |
|
Strain of Origin: |
Not Applicable
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATGCTGTTAGTGCCACCGGT and TGGGAGCTATAAGGTTAGCG, which resulted in a 4626 bp deletion beginning at Chromosome 11 position 87,979,468 bp and ending after 87,984,093 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000105250 and ENSMUSE00000674840 (exons 2 and 3) and 2441 bp of flanking intronic sequence including the splice acceptor, start site and donor and is predicted to result in a null allele.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|