Cacng3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cacng3^em1(IMPC)J
• Name: calcium channel, voltage-dependent, gamma subunit 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7520872
• Gene: Cacng3 Location: Chr7:122270967-122368616 bp, + strand Genetic Position: Chr7, 66.81 cM, cytoband F3
• Alliance: Cacng3^em1(IMPC)J page
• IMPC: Cacng3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTACAGTAGTGATCAACATC and GCAGCAGGTCCTCCACAACC, which resulted in a 289 bp deletion beginning at Chromosome 7 position 122,671,671 bp and ending after 122,671,959 bp (GRCm38/mm10). This mutation deletes 289 bp from ENSMUSE00001291041 (exon 1) including the start site and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cacng3 Mutation: 16 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)