Cacna1d^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cacna1d^em1(IMPC)J
• Name: calcium channel, voltage-dependent, L type, alpha 1D subunit; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7520869
• Gene: Cacna1d Location: Chr14:29761898-30213113 bp, - strand Genetic Position: Chr14, 18.43 cM, cytoband B
• Alliance: Cacna1d^em1(IMPC)J page
• IMPC: Cacna1d gene page

Mutation origin

• Strain of Origin: Not Applicable
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATGGCATCAGGATCTAGCA and TCTGTTATCATGTCTGTGCG, which resulted in a 455 bp deletion beginning at Chromosome 14 position 30,196,518 bp and ending after 30,196,972 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000619086 (exon 4) and 315 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 161 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cacna1d Mutation: 119 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)