Cacna1dem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Cacna1dem1(IMPC)J |
Name: |
calcium channel, voltage-dependent, L type, alpha 1D subunit; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:7520869 |
Gene: |
Cacna1d Location: Chr14:29761898-30213113 bp, - strand Genetic Position: Chr14, 18.43 cM, cytoband B
|
Alliance: |
Cacna1dem1(IMPC)J page
|
IMPC: |
Cacna1d gene page |
|
Strain of Origin: |
Not Applicable
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATGGCATCAGGATCTAGCA and TCTGTTATCATGTCTGTGCG, which resulted in a 455 bp deletion beginning at Chromosome 14 position 30,196,518 bp and ending after 30,196,972 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000619086 (exon 4) and 315 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 161 and early truncation 2 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|