Clcc1^em4Yiji
Endonuclease-mediated Allele Detail

Summary

• Symbol: Clcc1^em4Yiji
• Name: chloride channel CLIC-like 1; endonuclease-mediated mutation 4, Yichang Jia
• MGI ID: MGI:7520857
• Synonyms: Clcc1 KO
• Gene: Clcc1 Location: Chr3:108561229-108586156 bp, + strand Genetic Position: Chr3, 47.49 cM
• Alliance: Clcc1^em4Yiji page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Insertion
• Mutation details: Lysine codon 298 in exon 8 (ENSMUST00000106609) or 9 (ENSMUST00000029483) was targeted for change to alanine using an sgRNA (targeting TTGGTTGGTTCCACCAACAAAGG ) and an ssODN template with CRISPR/Cas9 technology. This allele is the result of incorrect repair, with the insertion or duplication of a C five nucleotides from the 3' end of the exon (GRCm39:chr3:108580229dup), resulting in a frameshift and a premature stop codon shortly thereafter. (J:338078)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Clcc1 Mutation: 45 strains or lines available

References

• Original: J:338078 Guo L, et al., Disruption of ER ion homeostasis maintained by an ER anion channel CLCC1 contributes to ALS-like pathologies. Cell Res. 2023 Jul;33(7):497-515
• All: 1 reference(s)