About   Help   FAQ
Clcc1em3Yiji
Endonuclease-mediated Allele Detail
Summary
Symbol: Clcc1em3Yiji
Name: chloride channel CLIC-like 1; endonuclease-mediated mutation 3, Yichang Jia
MGI ID: MGI:7520606
Synonyms: Clcc1 K298A
Gene: Clcc1  Location: Chr3:108561229-108586156 bp, + strand  Genetic Position: Chr3, 47.49 cM
Alliance: Clcc1em3Yiji page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsLysine codon 298 (AAG) in exon 8 (ENSMUST00000106609) or 9 (ENSMUST00000029483) was changed to alanine (GCG) (p.K298A) using an sgRNA (targeting TTGGTTGGTTCCACCAACAAAGG) and an ssODN template with CRISPR/Cas9 technology. The affected residue is evolutionary conserved and critical for the channel function of the encoded peptide. (J:338078)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Clcc1 Mutation:  45 strains or lines available
References
Original:  J:338078 Guo L, et al., Disruption of ER ion homeostasis maintained by an ER anion channel CLCC1 contributes to ALS-like pathologies. Cell Res. 2023 Jul;33(7):497-515
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory