About   Help   FAQ
Clcc1em1Yiji
Endonuclease-mediated Allele Detail
Summary
Symbol: Clcc1em1Yiji
Name: chloride channel CLIC-like 1; endonuclease-mediated mutation 1, Yichang Jia
MGI ID: MGI:7520604
Synonyms: Clcc1 S263R
Gene: Clcc1  Location: Chr3:108561229-108586156 bp, + strand  Genetic Position: Chr3, 47.49 cM
Alliance: Clcc1em1Yiji page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsSerine codon 263 (AGT) in exon 7 (ENSMUST00000106609) or 8 (ENSMUST00000029483) was changed to arginine (CGT) (p.S263R) using an sgRNA (targeting TGGATTGGACTGGAAGTCTCTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation found in amyotrophic lateral sclerosis (ALS) patients. (J:338078)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Clcc1 Mutation:  45 strains or lines available
References
Original:  J:338078 Guo L, et al., Disruption of ER ion homeostasis maintained by an ER anion channel CLCC1 contributes to ALS-like pathologies. Cell Res. 2023 Jul;33(7):497-515
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory