Ddx17em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Ddx17em1(IMPC)J |
Name: |
DEAD box helicase 17; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:7520045 |
Gene: |
Ddx17 Location: Chr15:79411937-79430942 bp, - strand Genetic Position: Chr15, 37.77 cM
|
Alliance: |
Ddx17em1(IMPC)J page
|
IMPC: |
Ddx17 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTATTCTGAAAAATTACAAG and CTATCTTTACTAGTAAACTA, which resulted in an 820 bp deletion beginning at Chromosome 15 position 79,540,391 bp and ending after 79,541,210 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000260669 and ENSMUSE00000557611 (exons 4 and 5) and 620 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 100 and early truncation 18 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
1 reference(s) |
|